CpG oligodeoxynucleotides with negative control, TLR9 ligand

Images

 
CpG oligodeoxynucleotides with negative control, TLR9 ligand [NBP2-26232] - Validation of CpG using the TLR9/HEK 293 cell line. The assay was performed using the NF-kB SEAPorter Assay Kit. The Vector/HEK 293 and ...read more

Product Details

Summary
Reactivity HuSpecies Glossary
Applications Func
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Order Details

CpG oligodeoxynucleotides with negative control, TLR9 ligand Summary

Description

Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'

(* Indicates a phosphorothioate modification)

Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3'

Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

Specificity
CpG ODN (2006) with negative control oligo, TLR9 ligand (human)

Applications/Dilutions

Dilutions
  • Ligand Activation 5 - 20 ug/ml
Application Notes
A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.
Reviewed Applications
Read 1 Review rated 5
using
NBP2-26232 in the following application:

Publications
Read Publications using
NBP2-26232 in the following applications:

Packaging, Storage & Formulations

Storage
Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Buffer
Sterile water
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Kit Components

Alternate Names for CpG oligodeoxynucleotides with negative control, TLR9 ligand

  • CpG oligodeoxynucleotides with negative control oligo, TLR9 ligand (human)
  • CpG oligodeoxynucleotides

Background

Synthetic oligodeoxynucleotides (ODN) containing unmethylated deoxycytosine-deoxyguanosine (CpG) motifs. These CpG motifs are present at a 20 fold greater frequency in bacterial DNA than mammalian DNA. CpG ODNs are recognized by Toll-like receptor 9 (TLR9). Two types of CpG ODNs have been identified based on their distinct activity on plasmacytoid dendritic cells (pDC), which are the key sensors of the CpG motifs. CpG Type A induces IFN-a production in pDC whereas Type B promotes survival, activation and maturation of pDC. The CpG ODN sequence differs between human and mouse, however both negative controls contain GpC instead of CpG.

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Publications for CpG oligodeoxynucleotides with negative control, TLR9 ligand (NBP2-26232)(6)

We have publications tested in 1 confirmed species: Human.

We have publications tested in 2 applications: Flow Cytometry Control, In vitro.


Filter By Application
Flow Cytometry Control
(1)
In vitro
(1)
All Applications
Filter By Species
Human
(3)
All Species
Showing Publications 1 - 6 of 6.
Publications using NBP2-26232 Applications Species
Karasawa T, Sato R, Imaizumi T et al. Expression of interferon-stimulated gene 20 (ISG20), an antiviral effector protein, in glomerular endothelial cells: possible involvement of ISG20 in lupus nephritis Renal failure 2023-12-01 [PMID: 37340981]
Liu Y, Diamond SL. Activation of Most Toll-Like Receptors in Whole Human Blood Attenuates Platelet Deposition on Collagen under Flow Journal of Immunology Research 2023-01-17 [PMID: 36703865] (Human) Human
Valencia Pacheco GJ, Pinzon Herrera F, Cruz Lopez JJ et al. Expression and activation of intracellular receptors TLR7, TLR8 and TLR9 in peripheral blood monocytes from HIV-infected patients. Colomb Med (Cali). 2013-06-30 [PMID: 24892454] (Flow Cytometry Control) Flow Cytometry Control
Kusagaya H, Fujisawa T, Yamanaka K et al. Toll-like receptor-mediated airway IL-17C enhances epithelial host defense in an autocrine/paracrine manner. Am. J. Respir. Cell Mol. Biol. 2014-01-01 [PMID: 23944933] (In vitro, Human)

Details:
TLR ligand treatment (primary normal human bronchial epithelial cells), Figs 1, S1. CpG-ODN was used at 10 ug/ml.
In vitro Human
Gillaux C, Mehats C, Vaiman D et al. Functional screening of TLRs in human amniotic epithelial cells. J Immunol. 2011-09-01 [PMID: 21775685]

Details:
TLR ligands: TLR1/2 (IMG-2201), TLR3 (IMG-2203), TLR4 (IMG-2204), TLR5 (IMG-2205), TLR6/2 (IMG-2206), TLR7 (IMG-2207), TLR9 (IMG-2209Hpt). The effects of ligand stimulation was measured by various readout assays, refer to the figures for details (Figs 2-8, S1).
Min Ruan, Zun Zhang, Siyi Li et al. Increased expression of Toll-like receptor-9 has close relation with tumour cell proliferation in oral squamous cell carcinoma. Arch Oral Biol. 2011-09-01 [PMID: 21333270] (Human) Human

Review for CpG oligodeoxynucleotides with negative control, TLR9 ligand (NBP2-26232) (1) 51

Average Rating: 5
(Based on 1 review)
We have 1 review tested in 1 species: Human.

Reviews using NBP2-26232:
Filter by Applications
WB
(1)
All Applications
Filter by Species
Human
(1)
All Species
Images Ratings Applications Species Date Details
  5
reviewed by:
Verified Customer
WB Human 07/01/2016
View

Summary

ApplicationWestern Blot
Sample TestedSH-SY5Y cells
SpeciesHuman

Product General Protocols

View specific protocols for CpG oligodeoxynucleotides with negative control, TLR9 ligand (NBP2-26232): Find general support by application which include: protocols, troubleshooting, illustrated assays, videos and webinars.

FAQs for CpG oligodeoxynucleotides with negative control, TLR9 ligand (NBP2-26232). (Showing 1 - 1 of 1 FAQs).

  1. I worked with your product NBP2-26232 (CpG ODN (2006)) on pDCs. In the data sheet, there is no record whether this CpG is type A or type B so I was wondering if you can clearly this for me. In addition, I wanted to know how this specific CpG is expected to influence the maturation status of pDCs?
    • Thank you for your inquiry about the CpG ODN (NBP2-26232). This sequence is Type B as shown in the chart on CpG ODN (NBP2-26238). As denoted on the data sheets, ODNs are synthetic forms of oligonucleotides, which contain unmethylated CpG motifs, and can induce cellular immune responses through the activation of Toll-like receptor 9 (TLR9). According to the published literature, Type B promotes survival, activation and maturation of pDC. We quality control the ODNs using our TLR9 stable cell lines as shown on the data sheets (Validation of CpG using the TLR9/HEK 293 cell line). There is considerable published literature regarding ODNs and the maturation of dendritic cells, for examples see these links (type b odn dendritic maturation & 2006 cpg odn dendritic). I would also encourage you consult the literature for additional information about this topic for example using the key words in the scholar.google.com that are most relevant to your model system.

Additional CpG oligodeoxynucleotides with negative control, TLR9 ligand Products

Blogs on CpG oligodeoxynucleotides with negative control, TLR9 ligand

There are no specific blogs for CpG oligodeoxynucleotides with negative control, TLR9 ligand, but you can read our latest blog posts.

Contact Information

Product PDFs

Recent Reviews

5
5
1
4
0
3
0
2
0
1
0

 
Verified Customer
07/01/2016
Application: WB
Species: Human