Negative Control oligodeoxynucleotide Human

• Reactivity: Hu
• Concentration: Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Negative Control oligodeoxynucleotide Human Summary

• Immunogen: Negative Control oligo-5' TGCTGCTTTTGTGCTTTTGTCGTT 3'
• Specificity: Negative control oligo for TLR9 ligand (human)

Packaging, Storage & Formulations

• Storage: Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
• Buffer: Sterile water
• Concentration: Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.