Negative Control oligodeoxynucleotide Human

Images

 
There are currently no images for Negative Control oligodeoxynucleotide Human (NBP2-31135).

Every product we sell is backed by Novus' 100% Guarantee. If you have used this product, please submit your images and reviews to earn reward points.

Product Details

Summary
Reactivity HuSpecies Glossary
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Order Details

Negative Control oligodeoxynucleotide Human Summary

Immunogen
Negative Control oligo-5' TGCTGCTTTTGTGCTTTTGTCGTT 3'
Specificity
Negative control oligo for TLR9 ligand (human)

Packaging, Storage & Formulations

Storage
Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Buffer
Sterile water
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Notes

This product is provided as 100 ug (13 nmole) in 100 ul of sterile water.

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.
Supplier Logo

Publications for Negative Control oligodeoxynucleotide Human (NBP2-31135) (0)

There are no publications for Negative Control oligodeoxynucleotide Human (NBP2-31135).
By submitting your publication information earn gift cards and discounts for future purchases.

Reviews for Negative Control oligodeoxynucleotide Human (NBP2-31135) (0)

There are no reviews for Negative Control oligodeoxynucleotide Human (NBP2-31135). By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
  • Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
  • Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen

FAQs for Negative Control oligodeoxynucleotide Human (NBP2-31135) (0)

There are no specific FAQs related to this product. Read our general customer & technical service FAQs.

Additional Negative Control oligodeoxynucleotide Human Products

Blogs on Negative Control oligodeoxynucleotide Human

There are no specific blogs for Negative Control oligodeoxynucleotide Human, but you can read our latest blog posts.

Contact Information

Product PDFs

Review this Product

Be the first to review our Negative Control oligodeoxynucleotide Human and receive a gift card or discount.