Negative Control oligodeoxynucleotide Human Summary
Immunogen |
Negative Control oligo-5' TGCTGCTTTTGTGCTTTTGTCGTT 3' |
Specificity |
Negative control oligo for TLR9 ligand (human) |
Packaging, Storage & Formulations
Storage |
Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. |
Buffer |
Sterile water |
Concentration |
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance. |
Notes
This product is provided as 100 ug (13 nmole) in 100 ul of sterile water.
Limitations
This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are
guaranteed for 6 months from date of receipt.
Publications for Negative Control oligodeoxynucleotide Human (NBP2-31135) (0)
There are no publications for Negative Control oligodeoxynucleotide Human (NBP2-31135).
By submitting your publication information earn gift cards and discounts for future purchases.
Reviews for Negative Control oligodeoxynucleotide Human (NBP2-31135) (0)
There are no reviews for Negative Control oligodeoxynucleotide Human (NBP2-31135).
By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
- Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
- Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen
FAQs for Negative Control oligodeoxynucleotide Human (NBP2-31135) (0)
Additional Negative Control oligodeoxynucleotide Human Products
Blogs on Negative Control oligodeoxynucleotide Human