CpG oligodeoxynucleotides

• Reactivity: Hu
• Applications: Func, In vitro, LA
• Concentration: Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

CpG oligodeoxynucleotides Summary

• Description:

  Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'
  
  (* Indicates a phosphorothioate modification)
  
  

  Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3'
  
  

  Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

• Specificity: CpG ODN Type B (2006)

Applications/Dilutions

• Dilutions:
  • Ligand Activation 5-20 ug/ml
• Application Notes: Use in functional, and in vitro reported in scientific literature (PMID 25957979). A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.

Packaging, Storage & Formulations

• Storage: Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
• Buffer: Sterile water
• Concentration: Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Notes

This product is provided as 100 ug (13 nmole) in 100 ul of sterile water.

Alternate Names for CpG oligodeoxynucleotides

• CpG ODN (2006)
• CpG ODN
• oligodeoxynucleotides (ODN)

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Publications for CpG oligodeoxynucleotides (NBP2-31134)(1)

Publication using NBP2-31134

• Nohmi K, Tokuhara D, Tachibana D et al. Zymosan Induces Immune Responses Comparable with Those of Adults in Monocytes, Dendritic Cells, and Monocyte-Derived Dendritic Cells from Cord Blood. J. Pediatr. 2015 May 06 [PMID: 25957979] (LA, Func, In vitro, Human)
  
  Details:
  CpG oligodeoxynucleotides (2006)/CpG LR9 ligand (Imgenex IMG-2209Hpt) was used for in-vitro stimulation experiments involving human heparinized cord or adult blood Monocytes, peripheral blood dendritic cells (DCs) and monocyte-derived DCs (MoDCs). CpG was employed at 1 uM concentration on Monocytes as well as on MoDCs and at 0.5 uM on DCs. See full text for experimental details and results.