CpG oligodeoxynucleotides

• Reactivity: Hu
• Applications: Func
• Concentration: Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

CpG oligodeoxynucleotides Summary

• Description:

  Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'
  
  (* Indicates a phosphorothioate modification)
  
  

  Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3'
  
  

  Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

• Specificity: CpG ODN Type B (2006)

Applications/Dilutions

• Dilutions:
  • Functional reported in scientific literature (PMID 25957979)
  • In vitro assay reported in scientific literature (PMID 25957979)
  • Ligand Activation 5-20 ug/ml
• Application Notes: A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.

Packaging, Storage & Formulations

• Storage: Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
• Buffer: Sterile water
• Concentration: Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Alternate Names for CpG oligodeoxynucleotides

• CpG ODN (2006)
• CpG ODN
• oligodeoxynucleotides (ODN)

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Publications for CpG oligodeoxynucleotides (NBP2-31134)(1)

Publication using NBP2-31134

• Nohmi K, Tokuhara D, Tachibana D et al. Zymosan Induces Immune Responses Comparable with Those of Adults in Monocytes, Dendritic Cells, and Monocyte-Derived Dendritic Cells from Cord Blood. J. Pediatr. 2015-05-06 [PMID: 25957979] (Func, In vitro, LA, Human)
  
  Details:
  Zymosan, TLR2 ligand (Imgenex IMG-2212) was used for in-vitro stimulation experiments involving human heparinized cord or adult blood Monocytes, peripheral blood dendritic cells (DCs) and monocyte-derived DCs (MoDCs). Zymosan was employed at 1 ug/mL concentration on Monocytes as well as on MoDCs and at 0.5 ug/mL on DCs. See full text for experimental details and results.