Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'
(* Indicates a phosphorothioate modification)
Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3'
Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.
Specificity
CpG ODN Type B (2006)
Applications/Dilutions
Dilutions
Ligand Activation 5-20 ug/ml
Application Notes
Use in functional, and in vitro reported in scientific literature (PMID 25957979). A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.
Publications
Read Publication using NBP2-31134 in the following applications:
Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Buffer
Sterile water
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.
Notes
This product is provided as 100 ug (13 nmole) in 100 ul of sterile water.
Alternate Names for CpG oligodeoxynucleotides
CpG ODN (2006)
CpG ODN
oligodeoxynucleotides (ODN)
Limitations
This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.
Publications for CpG oligodeoxynucleotides (NBP2-31134)(1)
We have publications tested in 1 confirmed species: Human.
We have publications tested in 3 applications: Func, In vitro, LA.
Reviews for CpG oligodeoxynucleotides (NBP2-31134) (0)
There are no reviews for CpG oligodeoxynucleotides (NBP2-31134).
By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen
FAQs for CpG oligodeoxynucleotides (NBP2-31134) (0)
Be the first to review our CpG oligodeoxynucleotides and receive a gift card or discount.
PRODUCT AVAILABILITY: Update Regarding the Evolving COVID-19 Situation
Bio-Techne appreciates the critical role that you and our products and services play in research efforts to further scientific innovation and discovery. We are continually assessing our manufacturing and supplier capabilities during the COVID-19 situation and are implementing precautionary measures to ensure uninterrupted supply of products and services. Currently, and as we abide by local shelter in place orders across the world, we are fully operational and do not anticipate any material supply disruptions across our Bio-Techne brands and product lines. As the situation evolves, our goal is to utilize preventive measures to reduce the threat that COVID-19 poses to our ability to meet the needs of our customers globally.