CpG oligodeoxynucleotides

Images

 
There are currently no images for CpG oligodeoxynucleotides (NBP2-31134).

Every product we sell is backed by Novus' 100% Guarantee. If you have used this product, please submit your images and reviews to earn reward points.

Product Details

Summary
Reactivity HuSpecies Glossary
Applications Func
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Order Details

CpG oligodeoxynucleotides Summary

Description

Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3'

(* Indicates a phosphorothioate modification)

Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3'

Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

Specificity
CpG ODN Type B (2006)

Applications/Dilutions

Dilutions
  • Functional reported in scientific literature (PMID 25957979)
  • In vitro assay reported in scientific literature (PMID 25957979)
  • Ligand Activation 5-20 ug/ml
Application Notes
A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.
Publications
Read Publication using
NBP2-31134 in the following applications:

Packaging, Storage & Formulations

Storage
Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Buffer
Sterile water
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Alternate Names for CpG oligodeoxynucleotides

  • CpG ODN (2006)
  • CpG ODN
  • oligodeoxynucleotides (ODN)

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Publications for CpG oligodeoxynucleotides (NBP2-31134)(1)

Reviews for CpG oligodeoxynucleotides (NBP2-31134) (0)

There are no reviews for CpG oligodeoxynucleotides (NBP2-31134). By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
  • Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
  • Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen

FAQs for CpG oligodeoxynucleotides (NBP2-31134) (0)

There are no specific FAQs related to this product. Read our general customer & technical service FAQs.

Additional CpG oligodeoxynucleotides Products

Blogs on CpG oligodeoxynucleotides

There are no specific blogs for CpG oligodeoxynucleotides, but you can read our latest blog posts.

Contact Information

Product PDFs

Review this Product

Be the first to review our CpG oligodeoxynucleotides and receive a gift card or discount.