CpG oligodeoxynucleotides Mouse

Images

 
CpG oligodeoxynucleotides Mouse [NBP2-26235] - CpG oligodeoxynucleotides Mouse Evaluation of the mCpG ODN 1826 ligand activity on NF-kB SEAPorter RAW cell line. Cell line is a stably transfected RAW 264.7 cell line that ...read more

Product Details

Summary
Reactivity MuSpecies Glossary
Applications Func
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Order Details

CpG oligodeoxynucleotides Mouse Summary

Description

Mouse Sequence CpG ODN (1826) Type B: 5' T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T 3

(* Indicates a phosphorothioate modification)

Negative Control oligo: 5' TCCATGAGCTTCCTGAGCTT 3'

Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

Specificity
CpG ODN (1826) with negative control oligo, TLR9 ligand (mouse)

Applications/Dilutions

Dilutions
  • Ligand Activation 5-20 ug/ml
Application Notes
A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.
Publications
Read Publication using NBP2-26235.

Packaging, Storage & Formulations

Storage
Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Buffer
Sterile water
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Kit Components

Alternate Names for CpG oligodeoxynucleotides Mouse

  • CpG oligodeoxynucleotides (ODN)
  • ODN

Background

Synthetic oligodeoxynucleotides (ODN) containing unmethylated deoxycytosine-deoxyguanosine (CpG) motifs. These CpG motifs are present at a 20 fold greater frequency in bacterial DNA than mammalian DNA. CpG ODNs are recognized by Toll-like receptor 9 (TLR9). Two types of CpG ODNs have been identified based on their distinct activity on plasmacytoid dendritic cells (pDC), which is the key sensors of the CpG motifs. CpG Type A induces IFN-a production in pDC whereas Type B strongly activates B cells and weakly activates IFN-a stimulation. The CpG ODN sequence differs between human and mouse, however both negative controls contain GpC instead of CpG.

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Publications for CpG oligodeoxynucleotides Mouse (NBP2-26235)(1)

Reviews for CpG oligodeoxynucleotides Mouse (NBP2-26235) (0)

There are no reviews for CpG oligodeoxynucleotides Mouse (NBP2-26235). By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
  • Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
  • Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen

Product General Protocols

View specific protocols for CpG oligodeoxynucleotides Mouse (NBP2-26235): Find general support by application which include: protocols, troubleshooting, illustrated assays, videos and webinars.

FAQs for CpG oligodeoxynucleotides Mouse (NBP2-26235) (0)

There are no specific FAQs related to this product. Read our general customer & technical service FAQs.

Additional CpG oligodeoxynucleotides Mouse Products

Blogs on CpG oligodeoxynucleotides Mouse

There are no specific blogs for CpG oligodeoxynucleotides Mouse, but you can read our latest blog posts.

Contact Information

Product PDFs

Review this Product

Be the first to review our CpG oligodeoxynucleotides Mouse and receive a gift card or discount.