CpG oligodeoxynucleotides Mouse Summary
| Description |
Mouse Sequence CpG ODN (1826) Type B: 5' T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T 3
(* Indicates a phosphorothioate modification)
Negative Control oligo: 5' TCCATGAGCTTCCTGAGCTT 3'
Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml. |
| Specificity |
CpG ODN (1826) with negative control oligo, TLR9 ligand (mouse) |
Applications/Dilutions
| Dilutions |
- Ligand Activation 5-20 ug/ml
|
| Application Notes |
A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation. |
| Publications |
|
Packaging, Storage & Formulations
| Storage |
Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. |
| Buffer |
Sterile water |
| Concentration |
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance. |
Kit Components
Alternate Names for CpG oligodeoxynucleotides Mouse
Background
Synthetic oligodeoxynucleotides (ODN) containing unmethylated deoxycytosine-deoxyguanosine (CpG) motifs. These CpG motifs are present at a 20 fold greater frequency in bacterial DNA than mammalian DNA. CpG ODNs are recognized by Toll-like receptor 9 (TLR9). Two types of CpG ODNs have been identified based on their distinct activity on plasmacytoid dendritic cells (pDC), which is the key sensors of the CpG motifs. CpG Type A induces IFN-a production in pDC whereas Type B strongly activates B cells and weakly activates IFN-a stimulation. The CpG ODN sequence differs between human and mouse, however both negative controls contain GpC instead of CpG.
Limitations
This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are
guaranteed for 6 months from date of receipt.
Publications for CpG oligodeoxynucleotides Mouse (NBP2-26235)(1)
Showing Publication 1 -
1 of 1.
Reviews for CpG oligodeoxynucleotides Mouse (NBP2-26235) (0)
There are no reviews for CpG oligodeoxynucleotides Mouse (NBP2-26235).
By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
- Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
- Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen
Product General Protocols
View specific protocols for CpG oligodeoxynucleotides Mouse (NBP2-26235):
Find general support by application which include: protocols, troubleshooting, illustrated assays, videos and webinars.
FAQs for CpG oligodeoxynucleotides Mouse (NBP2-26235) (0)
Additional CpG oligodeoxynucleotides Mouse Products
Blogs on CpG oligodeoxynucleotides Mouse