We're moving to rndsystems.com. Come with us!

After August 17, 2026, Novus Biologicals products and services will no longer be available on this website; you will access all products and services on rndsystems.com. Create your R&D Systems online account today.

CpG oligodeoxynucleotides Mouse

Images

 
There are currently no images for CpG oligodeoxynucleotides Mouse (NBP2-31132).

Every product we sell is backed by Novus' 100% Guarantee. If you have used this product, please submit your images and reviews to earn reward points.

Product Details

Summary
Reactivity MuSpecies Glossary
Applications Func
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Order Details

CpG oligodeoxynucleotides Mouse Summary

Description

Mouse Sequence CpG ODN (1826) Type B: 5' T*C*C*A*T*G*A*C*G*T*T*C*C*T*G*A*C*G*T*T 3' 

(* Indicates a phosphorothioate modification)

Negative Control oligo: 5' TCCATGAGCTTCCTGAGCTT 3'

Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml.

Specificity
CpG ODN Type B (1826)

Applications/Dilutions

Dilutions
  • Ligand Activation 5-20 ug/ml
Application Notes
A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation.
Publications
Read Publications using NBP2-31132.

Packaging, Storage & Formulations

Storage
Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Buffer
Sterile water
Concentration
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Alternate Names for CpG oligodeoxynucleotides Mouse

  • CpG oligodeoxynucleotides (ODN)
  • ODN

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.

Publications for CpG oligodeoxynucleotides Mouse (NBP2-31132)(2)

Reviews for CpG oligodeoxynucleotides Mouse (NBP2-31132) (0)

There are no reviews for CpG oligodeoxynucleotides Mouse (NBP2-31132). By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
  • Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
  • Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen

Product General Protocols

View specific protocols for CpG oligodeoxynucleotides Mouse (NBP2-31132): Find general support by application which include: protocols, troubleshooting, illustrated assays, videos and webinars.

FAQs for CpG oligodeoxynucleotides Mouse (NBP2-31132) (0)

There are no specific FAQs related to this product. Read our general customer & technical service FAQs.

Additional CpG oligodeoxynucleotides Mouse Products

Blogs on CpG oligodeoxynucleotides Mouse

There are no specific blogs for CpG oligodeoxynucleotides Mouse, but you can read our latest blog posts.

Contact Information

Product PDFs

Review this Product

Be the first to review our CpG oligodeoxynucleotides Mouse and receive a gift card or discount.