Negative Control oligodeoxynucleotide Mouse


There are currently no images for Negative Control oligodeoxynucleotide Mouse (NBP2-31133).

Every product we sell is backed by Novus' 100% Guarantee. If you have used this product, please submit your images and reviews to earn reward points.

Product Details

Reactivity MuSpecies Glossary
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Order Details

Negative Control oligodeoxynucleotide Mouse Summary

This item is the negative control oligo from the kit (NBP2-26235).
Negative Control oligo-5' TCCATGAGCTTCCTGACGTT 3'
Negative control oligo, TLR9 ligand (mouse)


Application Notes
This product is the negative control oligo for moust TLR9 ligand (NBP2-31132)

Packaging, Storage & Formulations

Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
Sterile water
Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.


This product is provided as 100 ug (16.4 nmole) in 100 ul of sterile water.


This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.
Supplier Logo

Publications for Negative Control oligodeoxynucleotide Mouse (NBP2-31133) (0)

There are no publications for Negative Control oligodeoxynucleotide Mouse (NBP2-31133).
By submitting your publication information earn gift cards and discounts for future purchases.

Reviews for Negative Control oligodeoxynucleotide Mouse (NBP2-31133) (0)

There are no reviews for Negative Control oligodeoxynucleotide Mouse (NBP2-31133). By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
  • Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
  • Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen

FAQs for Negative Control oligodeoxynucleotide Mouse (NBP2-31133) (0)

There are no specific FAQs related to this product. Read our general customer & technical service FAQs.

Additional Negative Control oligodeoxynucleotide Mouse Products

Blogs on Negative Control oligodeoxynucleotide Mouse

There are no specific blogs for Negative Control oligodeoxynucleotide Mouse, but you can read our latest blog posts.

Contact Information

Product PDFs

Review this Product

Be the first to review our Negative Control oligodeoxynucleotide Mouse and receive a gift card or discount.