Negative Control oligodeoxynucleotide Mouse

• Reactivity: Mu
• Concentration: Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Negative Control oligodeoxynucleotide Mouse Summary

• Description: This item is the negative control oligo from the kit (NBP2-26235).
• Immunogen: Negative Control oligo-5' TCCATGAGCTTCCTGACGTT 3'
• Specificity: Negative control oligo, TLR9 ligand (mouse)

Applications/Dilutions

• Application Notes: This product is the negative control oligo for moust TLR9 ligand (NBP2-31132)

Packaging, Storage & Formulations

• Storage: Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles.
• Buffer: Sterile water
• Concentration: Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance.

Limitations

This product is for research use only and is not approved for use in humans or in clinical diagnosis. Support products are guaranteed for 6 months from date of receipt.