We're moving to rndsystems.com. Come with us!

After August 17, 2026, Novus Biologicals products and services will no longer be available on this website; you will access all products and services on rndsystems.com. Create your R&D Systems online account today.

Recombinant S. pyogenes CRISPR-associated Protein 9, CF

Images

 
Quantitative analysis of the substrate cleavage by densitometry of the agarose gel. Error bars display standard error of 3 replicates. 9957-C9 has equivalent activity to a Leading Competitor's Cas9 using the insert ...read more
Agarose gel image of in vitro cleavage of DNA substrate into two DNA products by 9957-C9 and a Leading Competitor's Cas9.
2 μg/lane of Recombinant S. pyogenes CRISPR-Cas9 was resolved with SDS-PAGE under reducing (R) and non-reducing (NR) conditions and visualized by Coomassie® Blue staining, showing a band at ~130 kDa.

Product Details

Summary
Reactivity BaSpecies Glossary
Applications Enzyme Activity
Format
Carrier-Free

Order Details

Recombinant S. pyogenes CRISPR-associated Protein 9, CF Summary

Additional Information
Purified CAS9 with Nuclear Localization Sequence
Details of Functionality
Measured by its ability to cleave a targeted DNA substrate. S. pyogenes CRISPR-Cas9 achieves >80% substrate cleavage, as measured under the described conditions.
Source
E. coli-derived s. pyogenes CRISPR-Cas9 protein
APKKKRKVGIHGVPAAS. pyogenes CRISPR-Cas9
(Asp2-Asp1368)
Accession # Q99ZW2
KRPAATKKAGQAKK-KKGYGRKKRRQRRRG HHHHHH
N-terminusC-terminus
N-terminal Sequence
Ala
Protein/Peptide Type
Recombinant Proteins
Purity
>95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining
Endotoxin Note
<0.10 EU per 1 μg of the protein by the LAL method.

Applications/Dilutions

Dilutions
  • Enzyme Activity
Theoretical MW
164 kDa.
Disclaimer note: The observed molecular weight of the protein may vary from the listed predicted molecular weight due to post translational modifications, post translation cleavages, relative charges, and other experimental factors.
SDS-PAGE
133 kDa, reducing conditions

Packaging, Storage & Formulations

Storage
Use a manual defrost freezer and avoid repeated freeze-thaw cycles.
  • 6 months from date of receipt, -20 to -70 °C as supplied.
  • 3 months, -20 to -70 °C under sterile conditions after opening.
Buffer
Supplied as a 0.2 μm filtered solution in Tris, NaCl, EDTA, Glycerol and TCEP.
Purity
>95%, by SDS-PAGE visualized with Silver Staining and quantitative densitometry by Coomassie® Blue Staining
Assay Procedure
  • Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9
  • Recombinant Streptococcus pyogenes CRISPR-Cas9 (rS. pyogenes Cas9) (Catalog # 9957-C9)
  • PBR322 vector (NEB, Catalog # N3033S) digested with EcoRI-HF (NEB, Catalog # R3101S)*
  • Dharmacon synthetic sgRNA, targeting sequence: GAGGCAGACAAGGTATAGGG
  • Ethidium Bromide, 10 mg/mL (Amresco, Catalog # X328)
  • Ultrapure DNase/RNase-Free Distilled Water (Invitrogen, Catalog # 10977015), to prepare Assay Buffer
  • DNA gel

*Digest was gel purified using gel purification kit and eluted in EB buffer (10 mM Tris-HCl, pH 8.5).

  1. Prepare RNP Complex:
    a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer)
    b. 0.25 μg rS. pyogenes Cas9
    c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL
    d. Incubate for 5 minutes at 37 °C.
  2. Mix RNP Complex with 3.5 μL of 8.6 ng/µL of DNA Substrate (diluted in Assay Buffer, if possible).
  3. Incubate for 1 hour at 37 °C.
  4. Incubate for 10 minutes at 65 °C to dissociate enzyme from DNA.
  5. Load total reaction with loading dye on a 1% agarose gel.
  6. Run gel at 140 V for 40 minutes.
  7. Soak gel in 200 mL TAE with 150 μL of 10 mg/mL ethidium bromide for 1 hour.
  8. Use imaging software to detect and quantify hydrolysis of the DNA substrate.
Per Reaction:
  • rS. pyogenes Cas9: 0.25 μg
  • DNA Substrate: 30 ng
  • sgRNA: 600 nM

Notes

This product is produced by and ships from R&D Systems, Inc., a Bio-Techne brand.

Alternate Names for Recombinant S. pyogenes CRISPR-associated Protein 9, CF

  • Cas9
  • CRISPR
  • CRISPR/Cas9
  • CRISPR-associated endonuclease Cas9/Csn1
  • CRISPR-associated protein 9 nuclease
  • CRISPR-Cas9
  • CRISPR-Cas9/Csn1
  • csn1
  • SPy_1046
  • SPy1046
  • SpyCas9

Background

Streptococcus pyogenes Cas9 (CRISPR associated protein 9) is a 160 kDa RNA guided endonuclease that introduces site specific cleavage of double strand DNA (1). It is part of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) system found in many bacteria such as S. pyogenes and most archaea, which provide adaptive immunity against invading mobile genetic elements (such as viruses, transposable elements and conjugative plasmids) (2, 3). Upon viral infection, short viral DNA (known as "spacers") integrate into the host genome between CRISPR repeats, and RNA sequences (guide RNA or gRNA) with this genetic information help guide Cas9 protein to recognize and cut foreign DNA. Cas9 protein undergoes conformational changes upon gRNA binding that shift from non-DNA binding conformation into an active DNA binding conformation. In the Cas9-gRNA complex, the gRNA sequence remains accessible to interact with free DNA, and the extent to which the gRNA spacer and target DNA segment (known as "protospacer") match will determine the cut site (4). The presence of a 5′-NGG-3′ protospacer adjacent motif (PAM) sequence immediately downstream of protospacers is required for Cas9 cleavage of the foreign DNA. PAM is absent in bacterial CRISPR loci, therefore preventing cleavage of the host genome (4). Cas9 associates with other proteins of the acquisition machinery (Cas1, Cas2 and Csn2), presumably to provide PAM specificity to this process (5). This RNA guided nuclease system called CRISPR/Cas (CRISPR associated protein) has been widely applied to genome engineering with increased efficiency (6). The attached nuclear localization signals(NLSs) on the chimeric protein ensures nuclear compartmentalization in mammalian cells during gene editing (7).
  1. Feng, Z. et al. (2013) Cell 154:1380.
  2. Moineau. et al. (2010) Nature 468:67.
  3. Barrangou, R. et al. (2014) Molecular Cell 54:234.
  4. Charpentier, E. et al. (2011) Nature 471:602.
  5. Heler, R. et al. (2015) Nature 519:199.
  6. Thomson, J.A. et al. (2013) PNAS,110:15644.
  7. Cong, L. et al. (2013) Science 339:819.

Publications for CRISPR-Cas9 (9957-C9) (0)

There are no publications for CRISPR-Cas9 (9957-C9).
By submitting your publication information earn gift cards and discounts for future purchases.

Reviews for CRISPR-Cas9 (9957-C9) (0)

There are no reviews for CRISPR-Cas9 (9957-C9). By submitting a review you will receive an Amazon e-Gift Card or Novus Product Discount.
  • Review with no image -- $10/€7/£6/$10 CAD/¥70 Yuan/¥1110 Yen
  • Review with an image -- $25/€18/£15/$25 CAD/¥150 Yuan/¥2500 Yen

FAQs for CRISPR-Cas9 (9957-C9) (0)

There are no specific FAQs related to this product. Read our general customer & technical service FAQs.

Additional CRISPR-Cas9 Products

Blogs on CRISPR-Cas9.

Recent advances in CRISPR-Cas9
The CRISPR-Cas9 genome-engineering tool is a powerful opportunity for researchers to study individual gene function. CRISPR-Cas9, abbreviated for Clustered Regularly Interspaced Short Palindromic Repeats, is a bacterial defense system that can be r...  Read full blog post.

Top 4 Reasons: Why Use CRISPR-Cas9 Antibodies and How?
1. Verification of the success of transfectionWhy- If the CRISPR-Cas9 transfection is not successful, it would not be relevant to relate the observations from transfected cells to the expected outcome of gene editing experiment. How- CRISPR-Cas...  Read full blog post.

CRISPR/Cas9: Keep your friends close, but your viruses closer
"CRISPR", or clustered regularly interspaced short palindromic repeats, is an ancient bacterial mechanism that prevents the invasion of foreign pathogens to a host organism.  Specifically, the CRISPR sequence has been identified as a si...  Read full blog post.

Thomson Reuters Predicts 2016 Nobel Prize Winners
Here at Bio-Techne we always look forward to the annual announcements of winners of the highly coveted Nobel Prize – the greatest award in science. How can you go about predicting which scientists might be in line for a life-changing phone-call fro...  Read full blog post.

Meeting Report: 2nd International Antibody Validation Meeting
Bio-Techne brands Novus Biologicals® and R&D Systems® were proud to support the 2nd International Antibody Validation Meeting held at Bath University, on the 15-16 September, 2016. Almost 100 participants from around the world, including funde...  Read full blog post.

Application Highlight: Recent uses of TERF2 in immunofluorescence (IF)
Telomeres are a region of repeat nucleotide sequences located at the end of chromosomes to protect our DNA from becoming damaged via end-to-end fusion.  TERF2, or telomeric-repeat binding factor 2, is important for telomere integrity and aids in th...  Read full blog post.

Customers Who Bought This Also Bought

Contact Information

Product PDFs

Calculators

Concentration Calculator

The concentration calculator allows you to quickly calculate the volume, mass or concentration of your vial. Simply enter your mass, volume, or concentration values for your reagent and the calculator will determine the rest.

=
÷

Review this Product

Be the first to review our Recombinant S. pyogenes CRISPR-associated Protein 9, CF and receive a gift card or discount.