| Reactivity | HuSpecies Glossary |
| Applications | Func |
| Concentration | Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance. |
| Description | Human Sequence CpG ODN (2006) Type B: 5' T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T 3' Negative Control oligo: 5' TGCTGCTTTTGTGCTTTTGTGCTT 3' Functionality: This product is useful for the activation of TLR9 and the stimulation of TLR9 has been reported with 5-20 ug/ml. |
| Specificity | CpG ODN Type B (2006) |
| Dilutions |
|
|
| Application Notes | A TLR9/NF-kB SEAP reporter construct in a HEK 293 cell line was used as a model system for studying hTLR9 activation. |
|
| Publications |
|
| Storage | Store at 4C short term. Aliquot and store at -20C long term. Avoid freeze-thaw cycles. |
| Buffer | Sterile water |
| Concentration | Please see the protocols for proper use of this product. If no protocol is available, contact technical services for assistance. |